EPIK miRNA Assay Evaluation Kit (BIO-66044), 30 reakcji (Hi-ROX)

Uwaga!!! W CELU UZYSKANIA WIĄŻĄCEJ OFERTY SKONTAKTUJ SIĘ Z DOSTAWCĄ PRODUKTU- BLIRT S.A.

PROSZĘ O OFERTĘ

UWAGA: Zestaw zawiera wszystkie niezbędne odczynniki (m.in. odczynniki do odwrotnej transkrypcji i reakcji Real-Time PCR)!

Measure 3 miRNAs in 4 different samples.

Components

- 10x Multiplex RT primer
- 5x Reverse Transcriptase Buffer
- Reverse Transcriptase
- 2x SensiSMART™ Master Mix
- DEPC Water
- 3 tubes singleplex qPCR assay (miR-122-5p, miR-16-5p and miR-181a-5p)

miR-122-5p: liver miRNA –uggagugugacaaugguguuug
miR-16-5p: normalizer -uagcagcacguaaauauuggcg
miR-181a-5p: cancer miRNA –aacauucaacgcugucggugagu

Using advanced design concepts, a proprietary algorithm has been developed by MiRXES™ to create modified stem-loop miRNA specific reverse transcription primers and hemi-nested real-time PCR primer combinations, to maximize miRNA detection sensitivity while minimizing non-specific interactions. The assays use SYBR® Green rather than a probe-based system for detection, allowing rapid amplification when required. The resulting real-time PCR assays use SensiSMART™ enabling detection of extremely low levels of miRNA with high specificity, allowing the discrimination between closely related miRNA sequences.

If you need single assays, please contact Bioline Technical Support for advice.

EPIK miRNA Assays Movie / Dr. Simon Baker

https://www.youtube.com/watch?v=wFGfB-MjgwU

Features & Benefits

- Increased sensitivity RT and qPCR steps optimized to drive highly efficient amplification from limiting amounts (≥10pg) of total RNA
- Improved specificity pre-designed, novel, miRNA-specific primers for superior discrimination of even very closely related targets
- Faster protocol RNA to Ct in less than 2 hours for earlier results and increased throughput capacity
- Reliable data 7-log linear dynamic range for accurate quantification of low- and high- expressed targets in even limited sample volumes
- Convenience all necessary components included in the kit and formulated to minimize set-up time

Instrument Compatibility

Lo-ROX (BIO-66043) = ABI ViiA7; ABI 7500; ABI 7500 FAST; QuantStudio™ 3 Real-Time PCR System FAST; QuantStudio™ 5 Real-Time PCR System FAST; QuantStudio™ 6 Real-Time PCR system FAST; QuantStudio™ 7 Real-Time PCR system FAST; QuantStudio™ 12K Flex Real-Time PCR system FAST; BioRad® CFX96; Roche LightCycler® 480 (96 well block only).

Hi-ROX (BIO-66044) = ABI Fast 96-Well Block (0.1 ml, low profile) which is compatible with ABI Step One Plus.

Storage & Stability

All components are shipped on dry/blue ice and should be stored at -20°C upon receipt for optimum stability and the RNA Spike stored at -80°C after reconstitution. Repeated freeze/thaw cycles should be avoided. When stored under the recommended conditions and handled correctly, full activity of the reagents is retained until the expiry date on the outer box label.